View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_low_33 (Length: 347)
Name: NF1293_low_33
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 76 - 290
Target Start/End: Original strand, 46356589 - 46356803
Alignment:
| Q |
76 |
aagggtatcgttttattacgtctttggctttgctgcatacgtggtcacgtttcaaaatcacatgcgtagcaataaatcaaattaaaattttatgtgacat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356589 |
aagggtatcgttttattacgtctttggctttgctgcatacgtggtcacgtttcaaaatcacatgcgtagcaataaatcaaattaaaattttatgtgacat |
46356688 |
T |
|
| Q |
176 |
tggatccaagctaatgtcataaattaatgatgaatttcaacaaagcagggacagtttctaacgtttctcacagcttcttttaacaagttatcaatatatt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356689 |
tggatccaagctaatgtcataaattaatgatgaatttcaacaaagcagggacagtttctaacgtttctcacagcttcttttaacaagttatcaatatatt |
46356788 |
T |
|
| Q |
276 |
attggaaaatatatt |
290 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46356789 |
attggaaaatatatt |
46356803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University