View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_low_47 (Length: 284)
Name: NF1293_low_47
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 48 - 192
Target Start/End: Original strand, 10924372 - 10924516
Alignment:
| Q |
48 |
agagagaggttgtgatgatgatgatgatttgaagaagaaaggtttgcaaagttcatgcaattcttcaatggaacttttagtttcaaaggggtttgaaagt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10924372 |
agagagaggttgtgatgatgatgatgatttgaagaagaaaggtttgcaaagttcatgcaattcttcaatggaacttttagtttcaaaggggtttgaaagt |
10924471 |
T |
 |
| Q |
148 |
gaaaaaacttgacttgtttgttctgtagggtaaatagagaaaaag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10924472 |
gaaaaaacttgacttgtttgttctgtaggataaatagagaaaaag |
10924516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 134
Target Start/End: Complemental strand, 29998514 - 29998462
Alignment:
| Q |
82 |
aagaaaggtttgcaaagttcatgcaattcttcaatggaacttttagtttcaaa |
134 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| ||| ||| |||||| |
|
|
| T |
29998514 |
aagaaaggcttgcaaagttcatgcaactcttcaatggagcttctagcttcaaa |
29998462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University