View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_low_50 (Length: 274)
Name: NF1293_low_50
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 51766824 - 51766739
Alignment:
| Q |
103 |
atcattttaataattgggactgagtcttggcaatgaagcaaatgaaaatactaatgatttggttgagttgttgatatggtcatatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51766824 |
atcattttaataattgggactgagtcttggcaatgaagcaaatgaaaatactaatgatttggttgagttgttgatatggtcatatg |
51766739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University