View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_low_59 (Length: 251)
Name: NF1293_low_59
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 38730115 - 38729901
Alignment:
| Q |
1 |
gctatgctaagtgtgacgtctaatatcaagacataagaaaacattaccggttcaggtgttgggatgctagcgtttgcatcacccatgttagcccatgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38730115 |
gctatgctaagtgtgacgtctaatatcaagacataagaaaacattaccggttcaggtgtcgggatgctagcgtttgcatcacccatgttagcccatgcaa |
38730016 |
T |
 |
| Q |
101 |
tgtcaccacctttgatcaccatttctggttttgctccaaaaaaggacggtttccataatacaagatcagctaactttcccacctgcaagactaggtataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38730015 |
tgtcaccacctttgatcaccatttctggttttgctccaaaaaaggacggtttccataatacaagatcagctaactttcccacctgcaagactaggtataa |
38729916 |
T |
 |
| Q |
201 |
cggaaatgaggcagg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38729915 |
cggaaatgaggcagg |
38729901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University