View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_low_62 (Length: 249)
Name: NF1293_low_62
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_low_62 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 28 - 249
Target Start/End: Complemental strand, 30436580 - 30436357
Alignment:
| Q |
28 |
aaatgtttgtgattcgtcacacttatcggctcctgattctctttttaccgaacatcctgcagcttcagactctatcttgtggaaatctggcaataaccaa |
127 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30436580 |
aaatgtttgtgagtcgtcacacttatcagctcctgattctctttttaccgaacatcctgcagcttcagactctatcttgtggaaaactggcaataaccaa |
30436481 |
T |
|
| Q |
128 |
tttcagctgcaaccaagatagagtcgtgcttgcgagccatgtggatttcaaaatttctttgagcgactcctc--gtgggagtattgatgtggcagactgg |
225 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30436480 |
tttcagatgcaaccaagatagagtcgtgcgtgcgagccatgtggatttcaaaatttctttgagcgactcctcgtgtgggagtattgatgtggcagactgg |
30436381 |
T |
|
| Q |
226 |
cagtagcattttctgcacaaaaca |
249 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
30436380 |
cagtagcattttctgaacaaaaca |
30436357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University