View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12940_high_6 (Length: 247)

Name: NF12940_high_6
Description: NF12940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12940_high_6
NF12940_high_6
[»] chr3 (1 HSPs)
chr3 (16-230)||(35445919-35446133)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 35446133 - 35445919
Alignment:
16 atggaagaagtggtcagtccaattttctctccttgtagcatgagaaaatatgtgatttccaactaaaggagaaccaaaagtaatacagatgggagggata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35446133 atggaagaagtggtcagtccaattttctctccttgtagcatgagaaaatatgtgatttccaactaaaggagaaccaaaagtaatacagatgggagggata 35446034  T
116 cgatcggggaattttgtagttgggaagtttactaaggcccaaagtgctgccagaatagccactggaccaccagacgagtgtcctgcaaacactatctgct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35446033 cgatcggggaattttgtagttgggaagtttactaaggcccaaagtgctgccagaatagccactggaccaccagacgagtgtcctgcaaacactatctgct 35445934  T
216 tcttcttcttcattg 230  Q
    |||||||||||||||    
35445933 tcttcttcttcattg 35445919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University