View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12940_high_8 (Length: 242)
Name: NF12940_high_8
Description: NF12940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12940_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 21915925 - 21915696
Alignment:
| Q |
18 |
gcttgaagctttcatggcttctcctcaccaaataaattttgctgctattgttactgtcacatggaaggcgccaaccttgccttatgtgaaggtaaacaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21915925 |
gcttgaagctttcatggcttctcctcaccaaataaattttgctgctattgttactgtcacatggaaggcgccaaccttgccttatgtgaaggtaaacaca |
21915826 |
T |
 |
| Q |
118 |
tatagttatgttattggtgagtcagctgagtgtggttgta-----tttttgtgattatagaggctcattcctggattgtaaattgcatgcttgcacgatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21915825 |
tatagttatgttattggtgagtcagctgcgtgtggtggtatatattttttgtgattatagaggctcattcctggattgtaaattgcatgcttgcacaatc |
21915726 |
T |
 |
| Q |
213 |
tttgaagcggagctctatggctttatgttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21915725 |
tttgaagcggagctctatggctttatgttc |
21915696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University