View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12940_low_8 (Length: 242)

Name: NF12940_low_8
Description: NF12940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12940_low_8
NF12940_low_8
[»] chr7 (1 HSPs)
chr7 (18-242)||(21915696-21915925)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 21915925 - 21915696
Alignment:
18 gcttgaagctttcatggcttctcctcaccaaataaattttgctgctattgttactgtcacatggaaggcgccaaccttgccttatgtgaaggtaaacaca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21915925 gcttgaagctttcatggcttctcctcaccaaataaattttgctgctattgttactgtcacatggaaggcgccaaccttgccttatgtgaaggtaaacaca 21915826  T
118 tatagttatgttattggtgagtcagctgagtgtggttgta-----tttttgtgattatagaggctcattcctggattgtaaattgcatgcttgcacgatc 212  Q
    |||||||||||||||||||||||||||| ||||||| |||     ||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
21915825 tatagttatgttattggtgagtcagctgcgtgtggtggtatatattttttgtgattatagaggctcattcctggattgtaaattgcatgcttgcacaatc 21915726  T
213 tttgaagcggagctctatggctttatgttc 242  Q
    ||||||||||||||||||||||||||||||    
21915725 tttgaagcggagctctatggctttatgttc 21915696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University