View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12941_low_10 (Length: 335)
Name: NF12941_low_10
Description: NF12941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12941_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 317
Target Start/End: Complemental strand, 41431704 - 41431610
Alignment:
| Q |
223 |
cttattttgagaacattaattagcttttgcnnnnnnnnnnnnnncagaaatccatatacacgtacggactgtggacaagcattgagaacgttcct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41431704 |
cttattttgagaacattaattagcttttgcaaaaaaaagaaaaacagaaatccatatacacgtacggactgtggacaagcattgagaacgttcct |
41431610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University