View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12941_low_17 (Length: 240)
Name: NF12941_low_17
Description: NF12941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12941_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 3645479 - 3645270
Alignment:
| Q |
14 |
attattctatgtaaaagttagaagtatatatagtacaatcaagcatgagtaactaagattgaaaataccttctgctaaagagattaataacagcatctca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645479 |
attattctatgtaaaagttagaagtatatatagtacaatcaagcatgagtaactaagattgaaaataccttctgctaaagagattaataacagcatctca |
3645380 |
T |
 |
| Q |
114 |
gcaaaatatatagctagcaaagttcattctttaggcaaaaagattaaaatgttggaaaagacactttttgagctatatacttaaaaaatgcaacattgga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645379 |
gcaaaatatatagctagcaaagttcattctttaggcaaaaagattaaaatgttggaaaagacactttttgagctatatacttaaaaaatgcaacattgga |
3645280 |
T |
 |
| Q |
214 |
atagacatat |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
3645279 |
atagacatat |
3645270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University