View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12941_low_6 (Length: 364)
Name: NF12941_low_6
Description: NF12941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12941_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 7 - 348
Target Start/End: Complemental strand, 5665406 - 5665064
Alignment:
| Q |
7 |
tggtcaaagtcctcctcctcaatctattgctccctttaggcagctatatccgtctgctcccgaaaaataaccccttatcctctcctttgtaccaaacctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||| |||||||||||||||| |
|
|
| T |
5665406 |
tggtcaaagtcctcctcctcaatctattgctccctttaggcagctatatctgtctgctcccgaaaa-taaccccttaccctcttctttgtaccaaacctc |
5665308 |
T |
 |
| Q |
107 |
tcaaaagaccctctaggcttctgcctattctgaaagactgcaatgctgcttcagcgaactgctgagagaaatgtggtggctcaatgtacaactgagatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665307 |
tcaaaagaccctctaggcttctgcctattctgcaagactgcaacgctgcttcagcaaactgctgagagaaatgtggtggctcaatgtacaactgagatga |
5665208 |
T |
 |
| Q |
207 |
tgcttcttgcatccaatttaccgctccaaacatgtaattaacgatc--agagggtggagtagtggatattcagctgttggttgctcttgtggttgagact |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665207 |
tgcttcttgcatccaatttgccgctccaaacatgtaattaacgatcagagagggtggagtagtggatattcagctgttggttgctcttgtggttgagact |
5665108 |
T |
 |
| Q |
305 |
gctcctctggttcattcggaatccctcctgcctccctcagtttg |
348 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665107 |
gctcttctggttcattcggaatccctcctgcctccctcagtttg |
5665064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University