View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_38 (Length: 401)
Name: NF12942_high_38
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 11 - 383
Target Start/End: Complemental strand, 846933 - 846555
Alignment:
| Q |
11 |
agaatatcccattaactcgtttcaccggttccctcttgttcagctccggtttcgccacttccaactgtgatatcatatctagccaaccaaacaaacaatc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
846933 |
agaatatcccattaactcgtttcaccggttccctcttgttcagctccggtttcgccacttccaactgcgatatcatatctagccaaccaaacaaacaatc |
846834 |
T |
 |
| Q |
111 |
caaaataataatcagatatcaaataaacgactaaagttannnnnnngagtcttgcacaacacgcaagcaaggtgttcgagaaaatgcctcaaccaacaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
846833 |
caaaataataatcagatatcaaataaacgactaaagttatttttttgagtcttgcacaacacgcaagcaaggtgttcgagaaaatgcctcaaccaacaca |
846734 |
T |
 |
| Q |
211 |
aaggagtaacataccaga------tttgttgttgttgcatagagtgagagaaggtgaaggaaggttgaagagggaatgatgagaaagacgtgggtatgtg |
304 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
846733 |
aaggagtaacataccagacttgttgttgttgttgttgcatagagtgagagaaggtgaaggaaggttgaagagggaatgatgagaaagacatgggtatgtg |
846634 |
T |
 |
| Q |
305 |
atattgggagagtttttgatgctgaaggtgggaggtacagaggagaaagagggggtgcgaaaatggtgaatgggtttgt |
383 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
846633 |
atattgggaaagtttttgatgctgaaggtgggaggtacagaggagaaagagggggtgcgaaaatggtgaatgggtttgt |
846555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University