View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_46 (Length: 326)
Name: NF12942_high_46
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 7 - 313
Target Start/End: Original strand, 53278483 - 53278789
Alignment:
| Q |
7 |
ccaactgataatgccgcgagattttataaatggttcgaggtaagattgatatagattatgtagtttctttgatattgggtgtgagattattagtgttggg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278483 |
ccaactgataatgccgcgagattttataaatggttcgaggtaagattgatatagattatgtagtttctttgatattgggtgtgagattattagtgttggg |
53278582 |
T |
 |
| Q |
107 |
tttgtatatttattgcgtgattgtgattttgatttcaggaatttgaaggggaagaagattcgtttaagaatcttcagtatggtgtgtttggacttgggaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278583 |
tttgtatatttattgcgtgattgtgattttgatttcaggaatttgaaggggaagaagattcgtttaagaatcttcagtatggtgtgtttggacttgggaa |
53278682 |
T |
 |
| Q |
207 |
cagacagtatgagcattttaataaggtttgcactcaagcccttatgcattcttgtggttttctaagctttgactatggtgatggtgttgctagtttccgt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53278683 |
cagacagtatgagcattttaataaggtttgcactcaagcccttatgcattcttgtggttttctaagctttgactatagtgatggtgttgctagtttccgt |
53278782 |
T |
 |
| Q |
307 |
gctttct |
313 |
Q |
| |
|
||||||| |
|
|
| T |
53278783 |
gctttct |
53278789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University