View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_57 (Length: 292)
Name: NF12942_high_57
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 11 - 277
Target Start/End: Original strand, 47707769 - 47708035
Alignment:
| Q |
11 |
gatgaaatctaaaagggtgttgcacaagacaaagaggttgttatttgattgtgtgagagaacttgcaaaaagtcttccagataaagattgtaagcaattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
47707769 |
gatgaaatctaaaagggtgttgcacaagacaaagaggttgttatttgattgtgtgagagaacttacaaaaaatcttccagaaaaagattgtaagcaattc |
47707868 |
T |
|
| Q |
111 |
atgggtgccgaaaagttggggaagatgttatgggagaggacaaaagaatggagcgaaagaggtggaaattatgagagaaatctaagtaacttgctgaatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47707869 |
atgggtgccgaaaagttggggaagatgttatgggagaggacaaaagaatggagtgaaagaggtggaaattatgagagaaatctaagtaacttgctgaatt |
47707968 |
T |
|
| Q |
211 |
tggattacttggattcaattaatgaatggagtgaatttaagactgaggtgaaagatgttagtattga |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47707969 |
tggattacttggattcaattaatgaatggagtgaatttaagaccgaggtgaaagatgttagtattga |
47708035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University