View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_67 (Length: 254)
Name: NF12942_high_67
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 70 - 249
Target Start/End: Complemental strand, 1838207 - 1838020
Alignment:
| Q |
70 |
ataaagacagtttaatccgatgtcattgactctggaaaacaataactttaaagctatcatatcatggcccccaaattaacatctcttggtgaaaaaacaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1838207 |
ataaagacagtttaatccgatgtcattgactctggaaaacaataactttaaagctatcatatcatggcccccaaattaacatctcttggtgaaaaaagaa |
1838108 |
T |
|
| Q |
170 |
acatgtttttaaagttaatttttagaggaatggaagaatagttcaaaattagc--------ggtaaaatgatttaaagaataatctac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1838107 |
acatgtttttaaagttaatttttagaggaatggaagaatagttcaaaattagcttcatgaaggtaaaatgatttaaagaataatctac |
1838020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University