View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_68 (Length: 253)
Name: NF12942_high_68
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_68 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 1027944 - 1028176
Alignment:
| Q |
9 |
aaatgaatgagattatgattgtatgcaatccaaaacactcgtattaaccgcatttgattgcatttccatgtgcattttcaagcaatataaaaatcacaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1027944 |
aaatgaatgagattatgattgtatgcaatccaaaacactcgtattaatcacatttgattgcatttccatg------------caatataaaaatcacaat |
1028031 |
T |
 |
| Q |
109 |
gctaacgcaactacgattaacaattttgaagaagaatggaaaggttaagagaaatataactatacaaggatatcacatgtactttttaatgattgattta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
1028032 |
gctaacgcaactacgattaacaattttgaagaagaatggaaaggttaagagaaatataactatacaaggatatcacgtgtattttttaatgaatgattta |
1028131 |
T |
 |
| Q |
209 |
atcgtagccctctgtgttaatccattggacaatatttatttaatc |
253 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1028132 |
atcgtagccctctgtattaatccattggacaatatttatttaatc |
1028176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University