View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_72 (Length: 245)
Name: NF12942_high_72
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 54 - 228
Target Start/End: Complemental strand, 43094911 - 43094737
Alignment:
| Q |
54 |
acggccgcgcctgtagcaacagctgtggctagaatcaatgaaaaggcttgtttgtcctgttcattctctgcatcagttttctttggtttaacttcttctt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43094911 |
acggccgcgcctgtagcaacagctgtggctagaatcaatgaaaaggcttgtttgtcctgttcattctctgcatcagttttctttggtttaacatcttctt |
43094812 |
T |
 |
| Q |
154 |
ttggaggaagagatggaaccggaacaacagttattggtgatactcctccagatttccactcagcatcctcataat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094811 |
ttggaggaagagatggaaccggaacaacagttattggtgatactcctccagatttccactcagcatcctcataat |
43094737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University