View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_high_83 (Length: 214)
Name: NF12942_high_83
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_high_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 33887720 - 33887555
Alignment:
| Q |
19 |
atgaagcatcaactaccaaactcgctcgctgaagctgcagaaaatattctttcgtcggcttctgacgagtttcgctccgatcacactccgctgttgactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33887720 |
atgaagcatcaactaccaaactcgctagctgaagctgcagaaaatattctttcgtcggcttccgacgagtttcgctcggatcacactccgctgttgactt |
33887621 |
T |
 |
| Q |
119 |
gctgcagctccggcaaggttactgaaaccgacgacgatgacgttaaggagctcgacactacaccgttagatc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
33887620 |
gctgcagctccggcaaggttactgaaaccaac------gacgttaaggagctcgacactacaccgttagatc |
33887555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University