View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_44 (Length: 354)
Name: NF12942_low_44
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 354
Target Start/End: Complemental strand, 34573854 - 34573509
Alignment:
| Q |
19 |
gttaatcatagtgatcaatcaaaggtagtggattttgttggtgaggtacggattccggttggtt---------ttgaggataataagcaaatattgccac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34573854 |
gttaatcatagtgatcaatcaaaggtagtggattttgttggtgaggtacggattccggttggttcggttggttttgaggataataagcaaatattgccac |
34573755 |
T |
 |
| Q |
110 |
ccacttggttcgagcttcaatgttctaacaaaaacggcaaatttttcaacaaattttgtggtttgtttccttgtattagatgatcatgtttttgtatatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573754 |
ccacttggttcgagcttcaatgttctaacaagaacggcaaatttttcaacaaattttgtggtttgtttccttgtattagatgatcatgtttttgtatatg |
34573655 |
T |
 |
| Q |
210 |
atattatgctgattttgttttcaatgacaaatgttagtannnnnnngaataataaatgtcagtactttaatggttatgttagtattttctctgtcgtcaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573654 |
atattatgctgattttgttttcaatgacaaatgttagtatttttttgaataataaatgtcagtactttaatggttatgttagtattttctctgtcgtcaa |
34573555 |
T |
 |
| Q |
310 |
gattcaaa-ccctagacctttaactcatcatcgcatataatccatt |
354 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
34573554 |
gattcaaacccctagacctttaactcatcatcacatttaatccatt |
34573509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 263 - 334
Target Start/End: Original strand, 47774069 - 47774140
Alignment:
| Q |
263 |
aaatgtcagtactttaatggttatgttagtattttctctgtcgtcaagattcaaaccctagacctttaactc |
334 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||| | | || |||||||||||| |||||||||||| |
|
|
| T |
47774069 |
aaatgttagtatgttaattgttatgttagtattttctcccttgccaggattcaaaccctggacctttaactc |
47774140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University