View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_45 (Length: 341)
Name: NF12942_low_45
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 4281529 - 4281222
Alignment:
| Q |
16 |
atgtaagagtttaatttaagagtctcttaatttgtatacattatcagtgtaaaatgcattcaatgatgcgttaacgaggtatgacaaatcatgtgttttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281529 |
atgtaagagtttaatttaagagtctcttcatttatatacattatcagtgtaaaatgcattcaatgatgcgttaacgaggtatgacaaatcatgtgttttt |
4281430 |
T |
 |
| Q |
116 |
aatttatcaaaaagtaaaaagtaatattaacatcaaaattaccatgagataccctataacgaacacagcaaaaattgaaccaattactattgccaagtac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281429 |
aatttatcaaaaagtaaaaagtaatattaacatcaaaattaccatgagataccctataacgaacacagcaaaaattgaaccaattactattgccaagtac |
4281330 |
T |
 |
| Q |
216 |
caccagttgaagaatgagcttttggcatccctctcctccattgtgccttcagggaattgatcggcggcaaatgtttgtacgcacggcttgtgcccgccat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281329 |
caccagttgaagaatgagcttttggcatccctctcctccattgtgccttcagggaattgatcggcggcaaatgtttgtacgcacggcttgtgcccgccat |
4281230 |
T |
 |
| Q |
316 |
caccgaca |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
4281229 |
caccgaca |
4281222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University