View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_56 (Length: 301)
Name: NF12942_low_56
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 155 - 289
Target Start/End: Complemental strand, 2066062 - 2065933
Alignment:
| Q |
155 |
ttttgaaacaattttggttgtaagtcattggaattcccatttatgacgatatcaaagaatcaaagtgatagggaactgagaaaagtcttgaggtctaacc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
2066062 |
ttttgaaacaattttggttgtaagtcattgaaatttccatttattacgatatcaa--aatcaaaccgataggaaactgagaaaagtcttgaggtctaacc |
2065965 |
T |
|
| Q |
255 |
attgagattgatcatggctaggcttgcattagaat |
289 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |
|
|
| T |
2065964 |
attgagattg---atggctagggttgcattagaat |
2065933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 2066200 - 2066155
Alignment:
| Q |
17 |
taaactttatgttccccaacaaaacatagatataaaattaaaattt |
62 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
2066200 |
taaactttatgctcccctacaaaacatagatataaaattaaaattt |
2066155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 262
Target Start/End: Original strand, 2134714 - 2134754
Alignment:
| Q |
222 |
atagggaactgagaaaagtcttgaggtctaaccattgagat |
262 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2134714 |
atagggaactgaggaaagtctcgaggtctaaccattgagat |
2134754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University