View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_60 (Length: 277)
Name: NF12942_low_60
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 262
Target Start/End: Original strand, 33127236 - 33127487
Alignment:
| Q |
11 |
taattctaggaatatatttgagggaggaaagacacattttatatatttatatagtaaaaacacattttctctatttctcattcctgtttctaaacccgag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33127236 |
taattctaggaatatatttgagggaggaaagacacattttatatatttatatagtgaagacacattttctctatttttcattcctgtttctaaacccgag |
33127335 |
T |
 |
| Q |
111 |
tttcattataacatcgattttcaaaagattcttttcgaggtatttactggtagtattattgcatatgtactaaaccattagtaacatttggtttgacatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127336 |
tttcattataacatcgattttcaaaagattcttttcgaggtatttactggtagtattattgcatatgtactaaaccattagtaacatttggtttgacatt |
33127435 |
T |
 |
| Q |
211 |
ttgcaaatcaagatgtttccttttgctaatggataaagtgctacaagtaagt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127436 |
ttgcaaatcaagatgtttccttttgctaatggataaagtgctacaagtaagt |
33127487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University