View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_67 (Length: 257)
Name: NF12942_low_67
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 50241515 - 50241264
Alignment:
| Q |
1 |
tccatggaccatagtgttgtctctattgcagcaacattaatgttctctactatgtaagtcacattatcttcacttatttcaccttttttctcagcatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50241515 |
tccatggaccatagtgttgtctctattgcagcaacattaatgttctctactatgtaagtcacattatcttcacttatttcaccttttttctcagcatcta |
50241416 |
T |
|
| Q |
101 |
tgatatgatcaattgcacattttatctcatgcttctccccattggctgccattatttttctgnnnnnnnnntaaatactctatgttacatataaatggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50241415 |
tgatatgatcaattgcacattttatctcatgcttctccccattggctgccattatttttctg-aaaaaaaataaatactctatgttacatataaatggaa |
50241317 |
T |
|
| Q |
201 |
atcagttgnnnnnnnctatataatcaacatggattttgtggatatattcttgg |
253 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50241316 |
atcagttgaaaaaaactatataatcaacatggattttgtggatatatttttgg |
50241264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University