View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_73 (Length: 248)
Name: NF12942_low_73
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 234
Target Start/End: Original strand, 36863884 - 36864107
Alignment:
| Q |
10 |
aagaatatcatgaatgtacttaattttccttcnnnnnnnnccaaccctagtaaatagatttatcacatgactattcttactagtgatgcaacnnnnnnng |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
36863884 |
aagaaaatcatgaatgtacttaattttccttcttttttt-ccaaccctagtaaatagatttatcacatgactattcttactggtgatgcaactttttttg |
36863982 |
T |
|
| Q |
110 |
cagaaaattatgcttgttcaatacaagatcccaaacaccgttcacatgtctcaagattgtagcaatctaatatctcgcatttttgttgcaaatccaatga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36863983 |
cagaaaattatgcttgttcaatacaagatcccaaacaccgttcacatgtctcaagattgtagcaatctaatgtctcgcatttttgttgcaaatccaatga |
36864082 |
T |
|
| Q |
210 |
gagtatgtatatgttttgttgctga |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36864083 |
gagtatgtatatgttttgttgctga |
36864107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University