View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_77 (Length: 241)
Name: NF12942_low_77
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 27139619 - 27139395
Alignment:
| Q |
1 |
agaagactaaaacatacagctatatctagagaggttttgtgtaagactttgttgaaaattcaagtgagtgacgaagttcgacattggttaataataggtt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27139619 |
agaagactaaaacgtacagctatatctagagaggttttgtgtaagact--gttgaaaattcaagtgagtgacgaagttcgacattggttaataataggtt |
27139522 |
T |
|
| Q |
101 |
taataaaaacaatataagtgtaaaggcccatatactaaattactaatttccttaaggtttggagtcaagttatcgtgtcaagtctactattgtagtctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27139521 |
taataaaaacaatataagtgtaaaggcccatatactaaattactaatttccttaaggtttggagtcaagttatcgtgtcaagtctactattgtagtctgt |
27139422 |
T |
|
| Q |
201 |
cacttaggcctatgatatgtttctcct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27139421 |
cacttaggcctatgatatgtttctcct |
27139395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University