View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12942_low_78 (Length: 241)

Name: NF12942_low_78
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12942_low_78
NF12942_low_78
[»] chr1 (1 HSPs)
chr1 (10-226)||(48808024-48808244)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 48808244 - 48808024
Alignment:
10 cttgacacatgaatggacct-aagatgatgtagctagtgtcgaagaatccatagattgtacctttctgttagcaacaatcatgtaaaaagaagattgtaa 108  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48808244 cttgacacatgaatggaccttaagatgatgtagctagtggcgaagaatccatagattgtacctttctgttagcaacaatcatgtaaaaagaagattgtaa 48808145  T
109 aattactcataactctaaaatgcaattagaacacgtactttg---nnnnnnntaaaagaatgacgatgtgacgtctttgacaattgacagtggtccccct 205  Q
    ||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||    
48808144 aattactcataactctaaaatgcaattagaacacgtactttgaaaaaaagaaaaaaagaatgacgatgtgacgtctttgacaattgacagtggtccccct 48808045  T
206 gaatgccactacacactatct 226  Q
    |||||||||||||||||||||    
48808044 gaatgccactacacactatct 48808024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University