View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12942_low_85 (Length: 223)
Name: NF12942_low_85
Description: NF12942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12942_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 2466934 - 2467125
Alignment:
| Q |
15 |
cagagagaataatggactgtgacgcgacggagaaatctccgaggaagttgttgtaaccaagccatgttgtggaaccaatgcaaaagccaccaccatggaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466934 |
cagagagaataatggactgtgacgcgacggagaaatctccgaggaagttgttgtaaccaagccatgttgtggaaccaatgcaaaagccaccaccatggaa |
2467033 |
T |
 |
| Q |
115 |
ataaactaagagaggtaggagttttttggttggattgtttggaatgaagattcttcctgtgatgggttttgtagggtcaatgattacgtctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2467034 |
ataaactaagagaggtaggagttttttggttggattgtttggaatgaagattcttcctgtgatgggttttgtagggtcaatgattatgtctt |
2467125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University