View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_18 (Length: 504)
Name: NF12943_high_18
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 81 - 485
Target Start/End: Original strand, 44866290 - 44866706
Alignment:
| Q |
81 |
gccatcagcaattgatttcggtttcgattctggttccgatggaacaatgttatcattatcggtggctacatttgcagcggtggtggtgcctggggcttcg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866290 |
gccatcagcaattgatttcggtttcgattctggttccgatggaacaatgttatcattatcggtggctacatttgcagcggtggtggtgcctggggcttcg |
44866389 |
T |
 |
| Q |
181 |
agttctttggttctggtatcgatggcgtgtataatgaaattgagatgattttgaagttcatcgtacctgtttttgaaagcttgaattgaaattgacaaat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866390 |
agttctttggttctggtatcgatggcgtgtataatgaaattgagatgattttgaagttcatcgtacctgtttttgaaagcttgaattgaaattgacaaat |
44866489 |
T |
 |
| Q |
281 |
cgttgagttcattcaccgatttcgaaattttggcgccgacgtcgtgttggttttccggcggaattggagcgtcggaggctgtggagtggttattttcttc |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866490 |
cgttgagttcattcaccgatttcgaaattttggcgccgacgtcgtgttggttttccggcggaattggagcgtcggaggctgtggagtggttattttcttc |
44866589 |
T |
 |
| Q |
381 |
catgttgtagctgttctctg------------tgaaggaaacgaaaaccctaaaaattgagatgaagagagaaattcaagttacactgtatctactcagc |
468 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866590 |
catgttgtagctgttctctgtgagaatgaatttgaaggaaacgaaaaccctaaaaattgagatgaagagagaaattcaagttacactgtatctactcagc |
44866689 |
T |
 |
| Q |
469 |
ggcatcaactcgatcac |
485 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44866690 |
ggcatcaactcgatcac |
44866706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University