View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_40 (Length: 340)
Name: NF12943_high_40
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 201 - 321
Target Start/End: Original strand, 37689986 - 37690106
Alignment:
| Q |
201 |
attggaaccctagttttagcttgaaatgaatcaacattaactttattagaaatgattttactcactgatgcctgaaatctttcatttctagtaatgaaag |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37689986 |
attggagccctagttttagcttgaaatgaatcaacattaactttattagaaatgattttactcagtgatgcctgaaatctttcatttctagtaatgaaag |
37690085 |
T |
 |
| Q |
301 |
aagtggtgagatagagtagta |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37690086 |
aagtggtgagatagagtagta |
37690106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 113 - 227
Target Start/End: Original strand, 37689873 - 37689987
Alignment:
| Q |
113 |
gcagaaacactttgttattagactattgttttaatatttctaatggatggttattttacttttcttacctttttatgctgttcgcttgattggaacccta |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
37689873 |
gcagaaatactttgttattagactattgttttaatatttctaatggatggttattttacttttctttcctttttatgctgtttgcttgattggaacccta |
37689972 |
T |
 |
| Q |
213 |
gttttagcttgaaat |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37689973 |
gttttagcttgaaat |
37689987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 37689774 - 37689818
Alignment:
| Q |
14 |
gaagggaaaaggaacatctctgttttaggtggaaaattacaagaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37689774 |
gaagggaaaaggaacatctctgttttaggtggaaaattacaagaa |
37689818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 113 - 179
Target Start/End: Complemental strand, 40302702 - 40302636
Alignment:
| Q |
113 |
gcagaaacactttgttattagactattgttttaatatttctaatggatggttattttacttttctta |
179 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40302702 |
gcagaaatactttgttattagactattgttttaatatttctaatggatggttattttacttttctta |
40302636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 40302801 - 40302757
Alignment:
| Q |
14 |
gaagggaaaaggaacatctctgttttaggtggaaaattacaagaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40302801 |
gaagggaaaaggaacatctctgttttaggtggaaaattacaagaa |
40302757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University