View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_53 (Length: 259)
Name: NF12943_high_53
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 54600776 - 54601011
Alignment:
| Q |
1 |
cgatactattcttccagttgcttgcagcgcacagctaacatgattctgaattgcacaaagcgcgcaaaatccagcaatgtggcctatgaagataaaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54600776 |
cgatactattcttccagttgcttgcagcgcacagctaacatgattctgaattgcacaaagcgcgcaaaatccagcaatgtggcctataaagataaaacat |
54600875 |
T |
 |
| Q |
101 |
tgaaaatgtacttagaaacactatgaaccataaatttccttcgatcatcaatataaaccattgataaaagcaaatcattgacataatatggcaagtgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54600876 |
tgaaaatgtacttagaaacactatgaaccataaatttccttcattcatcaatataaaccattgataaaagcaaatcattgacataatatggcaagtgaca |
54600975 |
T |
 |
| Q |
201 |
gggaagtaaatgtattgcttacatgaacttttatgt |
236 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54600976 |
gagaagtaaatgtattgcttacatgaacttttatgt |
54601011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University