View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_56 (Length: 252)
Name: NF12943_high_56
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 85 - 237
Target Start/End: Complemental strand, 38947025 - 38946873
Alignment:
| Q |
85 |
aatcaacgtacaatttgcattgaaggacataataaaatcgaaattacacattttcatgtaaataaatgttatgtatccttagattgagtgaaaaagtata |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38947025 |
aatcaacgtacaatttgcattgaaggacataataaaatcgaaattacacattttcatgtaaataaatgttatgtatcctcagattgagtgaaaaagtata |
38946926 |
T |
 |
| Q |
185 |
cacgataggataagtatataaatcaattagatgaacgaaggcggttgatgatg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38946925 |
cacgataggataagtatataaatcaattagatgaacgaaggcggttgatgatg |
38946873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University