View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_59 (Length: 247)
Name: NF12943_high_59
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 46785526 - 46785757
Alignment:
| Q |
1 |
tgtgatggggttacataatgaatgcaacttctcgggcattgtccaacagcacactgaacttggtagtcttccccatgacctataaacagttgttgaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785526 |
tgtgatggggttacataatgaatgcaacttctcgggcattgtccaacagcgcactgaacttggtagtcttccccatgacctataaacagttgttgaagat |
46785625 |
T |
 |
| Q |
101 |
agcagtactcataaataaatcattaaaagaatgtcatttgcagagtgcatgcactcttctaaaacaagcgaagttatctagtacagtatgtcattcttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785626 |
agcagtactcataaataaatcattaaaagaatgtcatttgcagagtgcatgcactcttctaaaacaagcgaagttatctagtacagtatgtcattcttaa |
46785725 |
T |
 |
| Q |
201 |
ttaatgaatttctcaaaatgaagggaacaaca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46785726 |
ttaatgaatttctcaaaatgaagggaacaaca |
46785757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University