View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_64 (Length: 237)
Name: NF12943_high_64
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4051844 - 4051611
Alignment:
| Q |
1 |
tgtatggttattttatcaactaacatttcttttttaacctttttaagctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatat-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051844 |
tgtatggttattttatcaactaacatttcttttttaacctttttaagctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatatac |
4051745 |
T |
 |
| Q |
99 |
-----------tgataaaattagactctcaagcttcaccttggcttcaatcattgaccatgaagaagaagaaagtggcagaaatggaatgtcacaagcca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051744 |
cactgtgattttgataaaattagactctcaagcttcaccttggcttcaatcattgaccatgaagaagaagaaagtggcagaaatggaatgtcacaagcca |
4051645 |
T |
 |
| Q |
188 |
atggttgtcaagtttattgcaagatcctttttct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4051644 |
atggttgtcaagtttattgcaagatcctttttct |
4051611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University