View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_67 (Length: 231)
Name: NF12943_high_67
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_67 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 10736486 - 10736707
Alignment:
| Q |
1 |
ataaggagtttgttgtttgtcgccattgaagaatctaaaagctgctaatttctcttctgttgttgatcgtgtttgtctgtttattttttgttactgttta |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
10736486 |
ataaggagtttgttgtttgaggccattgaagaatctaaaagctgctaatttctcttctgttgttgatcgtgtttgtttgtttattttttgttggtgttta |
10736585 |
T |
|
| Q |
101 |
attgattatgggtatttgttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttgggatgttggtgtgttgttgcaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736586 |
attgattatgggtatttgttgatttggggatgttgctgactatttggatatttgtgagaaaaatgtattgatttgggatgttggtgtgttgttgcaggaa |
10736685 |
T |
|
| Q |
201 |
gggagaaaagagaatgatgatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10736686 |
gggagaaaagagaatgatgatg |
10736707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 117 - 222
Target Start/End: Complemental strand, 7351 - 7246
Alignment:
| Q |
117 |
tgttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttggg-atgttggtgtgttgttgcaggaagggagaaaagagaat |
215 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||| || ||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
7351 |
tgttgatttgggggtgttg-tggctatttgggtatttgtgaaaaaagggtattgatttggggatattgttgtgttattgaaggaagggagaaaagagaat |
7253 |
T |
|
| Q |
216 |
gatgatg |
222 |
Q |
| |
|
||||||| |
|
|
| T |
7252 |
gatgatg |
7246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 26802914 - 26802988
Alignment:
| Q |
149 |
tatttgtgagaaaaatgtattgatttggg-atgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
222 |
Q |
| |
|
||||||||| |||| |||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26802914 |
tatttgtgaaaaaagagtattgatatggggatgttgctgtgttgttgcaggaagggagaaaagagaatgatgatg |
26802988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 40110370 - 40110417
Alignment:
| Q |
175 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110370 |
gggatgttgctgtgttgttgcaggaagggagaaaagagaatgatgatg |
40110417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 24516724 - 24516677
Alignment:
| Q |
175 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24516724 |
gggatgttgttgtgttgttgcaggaagggagaaaagagaacgatgatg |
24516677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 41348637 - 41348590
Alignment:
| Q |
175 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41348637 |
gggatgttgttgtgttgttgcaggaagggagaaaagagaatgatgatg |
41348590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 214
Target Start/End: Original strand, 11968160 - 11968256
Alignment:
| Q |
119 |
ttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttg-ggatgttggtgtgttgttgcaggaagggagaaaagagaa |
214 |
Q |
| |
|
|||||||||| | ||||||| |||||| ||||||||| |||| ||||||||||| |||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
11968160 |
ttgatttgggatttttgctggttatttgagtatttgtgaaaaaagggtattgatttgaggatgttgttgtgttgttgtaggaagggagaagagagaa |
11968256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 22620859 - 22620902
Alignment:
| Q |
175 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgat |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22620859 |
gggatgttgctgtgttgttgcaggaagggagaaaagagaatgat |
22620902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University