View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_69 (Length: 230)
Name: NF12943_high_69
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 14526884 - 14527084
Alignment:
| Q |
12 |
gagcagagacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcgactatggagaagattagcgagca |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14526884 |
gagcaaagacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagca |
14526983 |
T |
 |
| Q |
112 |
gatgcgcagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggagatctttcattacttgactgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14526984 |
gatgcgcagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggatatctttcattacttgactgt |
14527083 |
T |
 |
| Q |
212 |
g |
212 |
Q |
| |
|
| |
|
|
| T |
14527084 |
g |
14527084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University