View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_high_70 (Length: 228)
Name: NF12943_high_70
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_high_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 31770455 - 31770257
Alignment:
| Q |
13 |
gagatgaagagggagatgaagagtcattggcagggatgatcagtggaagaagcggaattgtcctgccaaagagctttatcgcagggtcttttacctctga |
112 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770455 |
gagaagaagagggaaatgaagagtcgttggcagggatgatcagtggaagaagcggaattgtcctgccaaagagctttatcgcagggtcttttacctctga |
31770356 |
T |
|
| Q |
113 |
catttctgtaggaaaatctgtgtgcaactcagtt-ttttaggaaaaaatgagtgaaaatattatgagatggaatatatagtagttgttgaagtgttagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770355 |
catttctgtaggaaaatctgtgtgcaactcagtttttttaggaaaaaatgagtgaaaatattatgagatggaatatatagtagttgttgaagtgttagt |
31770257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University