View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_low_29 (Length: 430)
Name: NF12943_low_29
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Original strand, 14539081 - 14539492
Alignment:
| Q |
1 |
tcgtctatggtggtggtcctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtcataccaaattccctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539081 |
tcgtctatggtggtggtcctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtcataccaaattccctat |
14539180 |
T |
 |
| Q |
101 |
cgtacgtatcaagtgtcacttgttggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccacgtgtgccaccctccc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539181 |
cgtacgtatcaagtgtcacttgctggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccacgtgtgccaccctccc |
14539280 |
T |
 |
| Q |
201 |
atgctttgccgctgacgcagcaaggatacctccttcgtcctgcgttgcggccacgacagcactgcaggaacccacaggtgtatggccgccaaccatgcat |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
14539281 |
acgctttgccgctgacgcagcaaggatacctccttcgtcttgcgttgcggccacgacagcactgcaggatcccacgggtgtatggccgccaaccatgcat |
14539380 |
T |
 |
| Q |
301 |
gatccaatccctgatctagggactggatccattgcatgggttctctgctccttagtagtattggagcacggaaccaacgcgtccacagccatgccgttgg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
14539381 |
gatccaatccctgatctagggactggatccattgcatgggttctctgctccttagtagtattggagcagggaaccaacgcatccacagccatgccgttgg |
14539480 |
T |
 |
| Q |
401 |
aggcggctgtgg |
412 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14539481 |
aggcggctgtgg |
14539492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University