View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_low_56 (Length: 259)
Name: NF12943_low_56
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_low_56 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 4052169 - 4051911
Alignment:
| Q |
1 |
actatacaaggttgtttcattatacttttgttgttgttctgcttcttcattttgtttcataagactagtgcatgtttggattaacgattgactgaattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4052169 |
actatacaaggttgtttcattatacttttgttgttcttctgcttcttaattttgtttcataagactagtgcatgtttggattaacgattgactgaattag |
4052070 |
T |
|
| Q |
101 |
agtgtgttaccgttgttttgacaaaaattggatttgaagtttcaacaaattaaaattacggtgtcactgtaattttgtcaaaatttattgctaatttaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4052069 |
agtgtgttaccgttgttttgacaaaaattgaatttgaagtttcaacaaattaaaattacggtgtcactgtaattttgtcaaaatttattgctaatttaag |
4051970 |
T |
|
| Q |
201 |
caatgaatcctctttggttgatttttggctattttgttacagtttgtgtgtttcttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051969 |
caatgaatcctctttggttgatttttggctattttgttacagtttgtgtgtttcttcat |
4051911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University