View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_low_64 (Length: 238)
Name: NF12943_low_64
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2667479 - 2667700
Alignment:
| Q |
1 |
tgttcctggttttgtttcgttttctatctcaatctcgtttagttctttgatgtaagctttgtttgtttgctcattcattattctatttcgcacgtcgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2667479 |
tgttcctggttttgtttcgttttctatctcaatctcgtttagttctttgatgtaagctttgtttgtttgctcattcattattctatttcgcacgtcgata |
2667578 |
T |
|
| Q |
101 |
tatcaagaatgcagtgacattgaatcctcctccagagaggagttcgttggatttggcacctaaatcggaataatttaggtttcatatgttgacgactttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2667579 |
tatcaagaatgcagtgacattgaatcctcctccatagaggagttcgttggatttggcacctaaatcggaacaatttaggtttcatatgttgacgactttg |
2667678 |
T |
|
| Q |
201 |
ataatgtattccattgattact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2667679 |
ataatgtattccattgattact |
2667700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University