View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12943_low_69 (Length: 231)
Name: NF12943_low_69
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12943_low_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 3665511 - 3665712
Alignment:
| Q |
10 |
tccaagaatattttactctatccctcnnnnnnntaatattttactctacatattttcaaaatagatcgttggactgaatatttaattatattaccagatc |
109 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3665511 |
tccaagaatattttact--atccctcaaaaaaataatattttactctacatattttcaaaatagatcgttggactgaatatttaattatattaccagatc |
3665608 |
T |
|
| Q |
110 |
atctataaaaaaccattttacataatctaaaacttgaataatgagtcattttatatattattgtgatgtgatgcgtcaagactaatacacatttagatga |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3665609 |
atctataaaaaaacattttacataatctaaaacttgaataatgagtcattttatatattattgtgatgtgatgcgtcaagactaatacacatttggatga |
3665708 |
T |
|
| Q |
210 |
ttac |
213 |
Q |
| |
|
|||| |
|
|
| T |
3665709 |
ttac |
3665712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University