View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12943_low_75 (Length: 220)

Name: NF12943_low_75
Description: NF12943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12943_low_75
NF12943_low_75
[»] chr3 (1 HSPs)
chr3 (19-202)||(47371994-47372178)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 47372178 - 47371994
Alignment:
19 tctaaaatataaaccttttcagcaagtgagtgcaaataaa-gtatcatacacgaataaaggttggtcagaaaatcaaccaactctagtttctagataaat 117  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47372178 tctaaaatataaaccttttcagcaagtgagcgcaaataaaagtatcatacacgaataaaggttggtcagaaaatcaaccaactctagtttctagataaat 47372079  T
118 ttcaacttactttaaatttgtaatatatcatggaaataacaagtcataataattttttcataaacaaagtaagtaattgactata 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||    
47372078 ttcaacttactttaaatttgtaatatatcatggaaataacaagtcataaattttttttcataaacaaagtaagtaattgactata 47371994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University