View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12944_high_18 (Length: 311)
Name: NF12944_high_18
Description: NF12944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12944_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 28938488 - 28938214
Alignment:
| Q |
20 |
gccatgacaatccaccgtcttatatgtttctggaaaatatgatcttgcccgagtttttcttacaaatgcctctatatatattgtttgaacctacatatct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28938488 |
gccatgacaatccaccgtcttatatgtttctggaaaatatgatcttgcccgagtttttcttacaaatgcctctatatat--tgtttgaacctacatatct |
28938391 |
T |
 |
| Q |
120 |
tgaattccgattatataaaaaatgcttgatatattgccgttatttatgcttgataatatgttggtgttatgtatgcttgatatgttggtgttatatctat |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938390 |
tgaattctgattatataaaaaatgcttgatatattgctgttatttatgcttgataatatgttggtgttatgtatgcttgatatgttggtgttatatctat |
28938291 |
T |
 |
| Q |
220 |
attcaattctaagagatttcacaatttatgtggtatactttttatttttgtggtgttgcgattgaacactgccccag |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938290 |
cttcaattctaagagatttcacaatttatgtggtatactttttatttttgtggtgttgcgattgaacactgccccag |
28938214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University