View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12944_high_22 (Length: 275)
Name: NF12944_high_22
Description: NF12944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12944_high_22 |
 | |
|
| [»] scaffold0054 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0054 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 256
Target Start/End: Original strand, 38237 - 38478
Alignment:
| Q |
13 |
aatattggtctacgcaatcttcacaagcatttgaagaactcactgagatgaattttggtgttggatcccttccgctcatactctttcgtcattatcaaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38237 |
aatattggtctacgcaatcttcacaagcatttgaagaactcactgagatgaattttggtgttgga--ccttccgctcatactctttcgtcattatcaaaa |
38334 |
T |
|
| Q |
113 |
cttccaatacaccccacaaaaccgcacttgacgtccacaacagctttccagaacaacaaaggcactcactgttactcactctaaacaaaccacgaccacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38335 |
cttccaatacaccccacaaaaccgcacttgacgtccacaagagctttccaaaacaacaaaggcactcaccgttactcactctaaacaaaccacgaccacc |
38434 |
T |
|
| Q |
213 |
agctcgagaaccatccctattccctactcacgctatctgtattc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38435 |
agctcgagaaccatccctattccctactcacgctatctgtattc |
38478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University