View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12944_high_23 (Length: 253)
Name: NF12944_high_23
Description: NF12944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12944_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 95 - 236
Target Start/End: Complemental strand, 46365682 - 46365541
Alignment:
| Q |
95 |
ggaatataaaatctggatagaatgttattgaaatcttccctaatataatgatgaaacgaggttgccatgccatcaatattatactatatactcactatgc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46365682 |
ggaatataaaatctggatagaatgttattgaaatcttccctaatataatgatgaaacgaggttgccatgccatcaatattatactatatactcactatgc |
46365583 |
T |
 |
| Q |
195 |
gtagtaattatgtcatgttggatcagtaatttacagggttat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46365582 |
gtagtaattatgtcatgttggatcagtaatttacagggttat |
46365541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 46365741 - 46365665
Alignment:
| Q |
1 |
attagagaggtgtgaaacggggaagtgatatacacgtgaggggataattattgtcaagaggaatataaaatctggat |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46365741 |
attagagaggtgtgaaacggggaagtgatatacacgtgagggaataattattgtcaagaggaatataaaatctggat |
46365665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University