View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12944_high_6 (Length: 584)
Name: NF12944_high_6
Description: NF12944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12944_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 242 - 565
Target Start/End: Original strand, 47435702 - 47436025
Alignment:
| Q |
242 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcatttagaatctcagtgtcattggtggaa |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435702 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcatttagaatctcagtgtcattggtggaa |
47435801 |
T |
 |
| Q |
342 |
atccataaaggggatccagcaagagttaacattgtgagttcctccatagaaaccacagcaagttctacaatcgttgctttgtcaacttcattaggaattg |
441 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435802 |
atccataaaggggatccagcaagagttaagattgtgagttcctccatagaaaccacagcaagttctacaatcgttgctttgtcaacttcattaggaattg |
47435901 |
T |
 |
| Q |
442 |
agagggaccctaaggggtcattaccaccataacacagttcttctatcatgcttgaagatatgtcactattacttcctatttcaaatgcaggtgtaggcat |
541 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435902 |
agagggaccctaaggggtcattaccaccataacacagttcttctatcatgcttgaagatatgtcactattacttcctatttcaaatgcaggtgtaggcat |
47436001 |
T |
 |
| Q |
542 |
ttgaccaaatttagaggaggaacc |
565 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
47436002 |
ttgaccaattttagaggaggaacc |
47436025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University