View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12944_low_30 (Length: 221)
Name: NF12944_low_30
Description: NF12944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12944_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 2064907 - 2064825
Alignment:
| Q |
16 |
atatctacaatagtttaagatgtgttgatgaaatgttaatcaataagggattaacaacataaagattgcaacattttaatttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064907 |
atatctacaatagtttaagatgtgttgatgaaatgttaatcaataagggattaacaacataaagattgcaacattttaatttt |
2064825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 2064830 - 2064778
Alignment:
| Q |
152 |
aatttttgtttttgctttatttaggtccacaaacatacactcgtgcatgcttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064830 |
aatttttgtttttgctttatttaggtccacaaacatacactcgtgcatgcttg |
2064778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University