View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12945_low_10 (Length: 244)
Name: NF12945_low_10
Description: NF12945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12945_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 47051635 - 47051848
Alignment:
| Q |
17 |
caacaaatgctttaagatcttgttttcgtgaaatggagaatttaccactctttaacataggagtcttaatgcttaaggtatccaattcacactctaatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051635 |
caacaaatgctttaagatcttgttttcgtgaaatggagaatttaccgctctttaacataggagtcttaatgcttaaggtatccaattcacactctaatga |
47051734 |
T |
 |
| Q |
117 |
agcaagtcttaggcaatctactaaaaacaagtttgcatccaccttgagatcattgaataccaaatcgcagcataaaaccttgagatcacataaggatgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47051735 |
agcaagtcttaggcaatctactaaaaacaagtttgcatccaccttgagatcattgaataccaaatcgcagcataaaaccttgagatgacataaggatgaa |
47051834 |
T |
 |
| Q |
217 |
cttactatcacagg |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47051835 |
cttactatcacagg |
47051848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University