View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12946_low_4 (Length: 293)
Name: NF12946_low_4
Description: NF12946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12946_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 46754955 - 46755222
Alignment:
| Q |
1 |
tttcatcaaactagatcagactacactttttgatctactcttggttagttttgatttctatttcttttatctaattattgtgtcgattttggcattatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46754955 |
tttcatcaaactagatcagactacactttttgatctactcttggttagttttgatttctatttcttttatctaattattgtgtcgattttggcattatat |
46755054 |
T |
|
| Q |
101 |
gatgatttagggtttctttggaaatttttagtctgtttccgattaatgtgatttggagagacctttcaagtgtttgaaattgcaattttattggttaagt |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46755055 |
gatgatttaggatttctttggaaatttttaggctgtttccgattaatgtgattt----agacctttcaagtgtttgaaattgcaattttattggttaagt |
46755150 |
T |
|
| Q |
201 |
gatgcaatattattagtagtaggttctctctttgtcaaacttatcaacttgttcaaattcagaagtgcctta |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46755151 |
gatgcaatattattagtagtaggttctctctttgtcaaacttatcaacttgttcaaattcagaagtgcctta |
46755222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 134 - 272
Target Start/End: Complemental strand, 46757597 - 46757461
Alignment:
| Q |
134 |
tgtttccgattaatgtgatttggagagacctttcaagtgtttgaaattgcaattttattggttaagtgatgcaatattattagtagtaggttctctcttt |
233 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||| | ||| || ||||||||||||| ||| ||||||||||| |||||||| |||||||| | |
|
|
| T |
46757597 |
tgtttccatttaatgtgatttagcaagacctttcaactatttagaactgcaattttattgtttatgtgatgcaatagtattagtattaggttctttag-- |
46757500 |
T |
|
| Q |
234 |
gtcaaacttatcaacttgttcaaattcagaagtgcctta |
272 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
46757499 |
gtcaaacttattgccttgttcaaattaagaagtacctta |
46757461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University