View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12946_low_7 (Length: 239)
Name: NF12946_low_7
Description: NF12946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12946_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 15926354 - 15926225
Alignment:
| Q |
1 |
ctttgcaaatccggtaaacgcttgatgtgaaaaa-atatttcacatcgaattcttttaccgcgatgtgaaaagataagat-tttttccacccttaatagg |
98 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15926354 |
ctttgcaaatcccgtaaacacttgatgtgaaaaacatatttcacatcgaattcttttaccgcgatgtgaaaagataagatatttttccacccttaatagg |
15926255 |
T |
|
| Q |
99 |
ataaccataaccagatataaattttctacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15926254 |
ataaccataaccagatataaattttctacc |
15926225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University