View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12946_low_8 (Length: 237)
Name: NF12946_low_8
Description: NF12946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12946_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 4 - 219
Target Start/End: Original strand, 15926382 - 15926597
Alignment:
| Q |
4 |
tacaccgatgtgaaaacagtttttcacattgtgtgttcaacgatcgggcaaaataccaagatacatcacctatattcacatcggttaaagaattgatgtg |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||| | |||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15926382 |
tacaccaatgtgaaaacagtttttcacattgagtgttcaacaactaggcaaagtaccaagatacatcacctatgttcacatcggttaaagaattgatgtg |
15926481 |
T |
|
| Q |
104 |
aaatgtgcattaaatagatgtaaaaaatctattatgcactagtgtcctttgatttatttttcccatactgatagaaattttataaaaagtaacttataat |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
15926482 |
aaatgtgcattaaatagatgtaaaaagtctattatgcaccaatgtcctttgatttatttttcccatactgatagaaattttataaaaagtaactcatatt |
15926581 |
T |
|
| Q |
204 |
tttttgcgatataata |
219 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
15926582 |
tttttccgatataata |
15926597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University